Lauren Hart (@laurenhart_98) 's Twitter Profile
Lauren Hart

@laurenhart_98

PhD student @UMich Chem Bio | Texas Ex | Multi-Omics of Harmful Algal blooms 🦠 (Sherman/Dick labs) | Hacky sack enthusiast

ID: 1216890060471226370

calendar_today14-01-2020 01:09:41

291 Tweet

344 Takipçi

725 Takip Edilen

NOAA Great Lakes Environmental Research Laboratory (@noaa_glerl) 's Twitter Profile Photo

These #WomenOfNOAA are at the forefront of advancing our #GreatLakes science, service & stewardship! Earlier this month, these leaders visited Capitol Hill to talk w/ Congress members about NOAA’s GL programs in their districts & learn about their priorities. #WomensHistoryMonth

These #WomenOfNOAA are at the forefront of advancing our #GreatLakes science, service & stewardship!

Earlier this month, these leaders visited Capitol Hill to talk w/ Congress members about NOAA’s GL programs in their districts & learn about their priorities.
#WomensHistoryMonth
Elisabeth Bik (@microbiomdigest) 's Twitter Profile Photo

Too Many Labs Run Like This Derek Lowe writes about ‘a principal investigator steamrolling his own grad students and postdocs, hiding key details and pressuring everyone to get papers out no matter what misgivings they might be feeling.’ science.org/content/blog-p…

Twist Bioscience (@twistbioscience) 's Twitter Profile Photo

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

George Bullerjahn (@gbullerjahn) 's Twitter Profile Photo

Check out the new paper in JGLR by ⁦Brittany N. Zepernick, PhD⁩ from ⁦Steven Wilhelm⁩ lab discussing characteristics of freshwater algal blooms: A tale of two blooms: do ecological paradigms for algal bloom success and succession require revisiting? sciencedirect.com/science/articl…

CIGLR (@ciglr_um) 's Twitter Profile Photo

🚨 #CIGLR is #HIRING, 3 positions! Plz SHARE! 1) Biophysical Modeling Analyst 2) Postdoc in Microbial & Molecular Ecology 3) Postdoc in #GreatLakes Hydrodynamic Modeling Learn more & apply: ciglr.seas.umich.edu/opportunities/… #GreatLakesSci #GreatLakesInfo #GreatLakesJobs #GreatLakesJob

🚨 #CIGLR is #HIRING, 3 positions! Plz SHARE!

1) Biophysical Modeling Analyst
2) Postdoc in Microbial & Molecular Ecology
3) Postdoc in #GreatLakes Hydrodynamic Modeling

Learn more & apply: ciglr.seas.umich.edu/opportunities/…

#GreatLakesSci #GreatLakesInfo #GreatLakesJobs #GreatLakesJob
Michael Twiss (@mtwiss) 's Twitter Profile Photo

Ten years ago! IAGLR Conference in Hamilton, ON and the IAGLR Scholarship Fund-Raising hockey game (the Defy Cup) with IAGLR Team Canada facing IAGLR Team USA. For #IAGLR24, it will happen again in Windsor, ON. Interested in lacing them up? DM for more information.

Ten years ago! <a href="/IAGLR/">IAGLR</a> Conference in Hamilton, ON  and the IAGLR Scholarship Fund-Raising hockey game (the Defy Cup) with IAGLR Team Canada facing IAGLR Team USA. For #IAGLR24, it will happen again in Windsor, ON.  Interested in lacing them up? DM for more information.
Nigel Mouncey (@nigeljmouncey) 's Twitter Profile Photo

Happy to report that my work with Rebecca on building a compendium of metabolomic and genomic datasets for Cyanobacteria and their Natural Products is now out: authors.elsevier.com/c/1iuf39pi-d-ze

GTDB (@ace_gtdb) 's Twitter Profile Photo

GTDB-Tk v2.4.0 has been released along with reference data for GTDB R09-RS220. Updating to the latest reference data is recommended. More information about GTDB-Tk can be found at github.com/Ecogenomics/GT….

NOAA Great Lakes Environmental Research Laboratory (@noaa_glerl) 's Twitter Profile Photo

Today is our 50th birthday!! 🥳 Designated on April 25, 1974, GLERL was established to provide a focus for NOAA’s environmental and ecosystem research in the Laurentian #GreatLakes. Check out the story of our first 50 yrs of science in service to society! noaaglerl.blog/2024/04/25/noa…

Today is our 50th birthday!! 🥳 Designated on April 25, 1974, GLERL was established to provide a focus for NOAA’s environmental and ecosystem research in the Laurentian #GreatLakes.

Check out the story of our first 50 yrs of science in service to society! noaaglerl.blog/2024/04/25/noa…
Rogier Braakman (@rogier_braakman) 's Twitter Profile Photo

Please RT! Looking for bioinformatics technician to study how diversity of heterotrophic metabolisms shapes ocean C cycle. Part of ccomp-stc.org. Collaborative, open, team science. Opportunity to gain research experience before graduate school. careers.peopleclick.com/careerscp/clie…

Please RT! Looking for bioinformatics technician to study how diversity of heterotrophic metabolisms shapes ocean C cycle. Part of ccomp-stc.org. Collaborative, open, team science. Opportunity to gain research experience before graduate school. 

careers.peopleclick.com/careerscp/clie…
Ohio Sea Grant (@ohioseagrant) 's Twitter Profile Photo

NEW RESEARCH: Read about how harmful algal blooms start, persist, and produce toxins across three Great Lakes states — part of the first highly-integrated study of its kind in the region! ohioseagrant.osu.edu/news/2024/1gn2…

NEW RESEARCH: Read about how harmful algal blooms start, persist, and produce toxins across three Great Lakes states — part of the first highly-integrated study of its kind in the region!

ohioseagrant.osu.edu/news/2024/1gn2…
Bright Giant (@bright_giant) 's Twitter Profile Photo

#SIRIUSUpdate: We are thrilled to announce the release of #SIRIUS6 introducing new features to enhance your mass spectrometry analysis of small molecules. ⬇ github.com/sirius-ms/siri… #MSNovelist #API #UntargetedAnalysis #StructureElucidation #SmallMolecules #Release #ASMS2024

#SIRIUSUpdate: We are thrilled to announce the release of #SIRIUS6 introducing new features to enhance your mass spectrometry analysis of small molecules.

⬇ github.com/sirius-ms/siri…

#MSNovelist #API #UntargetedAnalysis #StructureElucidation #SmallMolecules #Release #ASMS2024
George Bullerjahn (@gbullerjahn) 's Twitter Profile Photo

Want to know about the microbiology of Lake Victoria and potential cyanotoxins? Check out our new paper in EMiR dx.doi.org/10.1111/1758-2… by the amazing X-less Kate Brown with great help from Ryan Wagner, KMFRI, Kisii University, Mike McKay and Prof. Lewis Sitoki:

Lauren Hart (@laurenhart_98) 's Twitter Profile Photo

Excited to see Colleen Yancey, PhD and I's (among many coauthors Greg Dick David H. Sherman Ashu Tripathi) joint effort out now! Spoiler alert that these bugs are capable of producing much more than microcystins... doi.org/10.1128/msyste…