These #WomenOfNOAA are at the forefront of advancing our #GreatLakes science, service & stewardship! Earlier this month, these leaders visited Capitol Hill to talk w/ Congress members about NOAA’s GL programs in their districts & learn about their priorities. #WomensHistoryMonth

Too Many Labs Run Like This Derek Lowe writes about ‘a principal investigator steamrolling his own grad students and postdocs, hiding key details and pressuring everyone to get papers out no matter what misgivings they might be feeling.’ science.org/content/blog-p…

AATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAGAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTAAAATACCCACATCAACGGCTGACATGAAAGGGAGTAGGAAAAGTGCGAGCCTACATGAGCCCCCAGAATTCTGTAATTCCTCAGCTGA

Check out the new paper in JGLR by ⁦Brittany N. Zepernick, PhD⁩ from ⁦Steven Wilhelm⁩ lab discussing characteristics of freshwater algal blooms: A tale of two blooms: do ecological paradigms for algal bloom success and succession require revisiting? sciencedirect.com/science/articl…

🚨 #CIGLR is #HIRING, 3 positions! Plz SHARE! 1) Biophysical Modeling Analyst 2) Postdoc in Microbial & Molecular Ecology 3) Postdoc in #GreatLakes Hydrodynamic Modeling Learn more & apply: ciglr.seas.umich.edu/opportunities/… #GreatLakesSci #GreatLakesInfo #GreatLakesJobs #GreatLakesJob

I can't believe this. Shot from Mansfield, TX at 500mm, handheld, cropped.

Ten years ago! IAGLR Conference in Hamilton, ON and the IAGLR Scholarship Fund-Raising hockey game (the Defy Cup) with IAGLR Team Canada facing IAGLR Team USA. For #IAGLR24, it will happen again in Windsor, ON. Interested in lacing them up? DM for more information.

Happy to report that my work with Rebecca on building a compendium of metabolomic and genomic datasets for Cyanobacteria and their Natural Products is now out: authors.elsevier.com/c/1iuf39pi-d-ze

GTDB-Tk v2.4.0 has been released along with reference data for GTDB R09-RS220. Updating to the latest reference data is recommended. More information about GTDB-Tk can be found at github.com/Ecogenomics/GT….

Today is our 50th birthday!! 🥳 Designated on April 25, 1974, GLERL was established to provide a focus for NOAA’s environmental and ecosystem research in the Laurentian #GreatLakes. Check out the story of our first 50 yrs of science in service to society! noaaglerl.blog/2024/04/25/noa…

Please RT! Looking for bioinformatics technician to study how diversity of heterotrophic metabolisms shapes ocean C cycle. Part of ccomp-stc.org. Collaborative, open, team science. Opportunity to gain research experience before graduate school. careers.peopleclick.com/careerscp/clie…

NEW RESEARCH: Read about how harmful algal blooms start, persist, and produce toxins across three Great Lakes states — part of the first highly-integrated study of its kind in the region! ohioseagrant.osu.edu/news/2024/1gn2…

NEW Seagull Feature: ‘Omics data from GLAMR. youtu.be/oHR2qDVZw8M?si… supported by CIGLR NOAA Great Lakes Environmental Research Laboratory NOAA Research Check it out: seagull.glos.org.

Such a lovely week of Great Lakes science, thanks IAGLR and Robert Michael McKay for all the coordination 🧬🧪🥼 can’t wait to share this work soon!

What if there was an antibiotic that doesn't disrupt the gut microbiome? There is now. A discovery published nature today nature.com/articles/s4158… Paul Hergenrother and colleagues University of Illinois justsaysinmice

#SIRIUSUpdate: We are thrilled to announce the release of #SIRIUS6 introducing new features to enhance your mass spectrometry analysis of small molecules. ⬇ github.com/sirius-ms/siri… #MSNovelist #API #UntargetedAnalysis #StructureElucidation #SmallMolecules #Release #ASMS2024

Ecstatic to see this center announced and for all the science to come out of it. Go Great Lakes team! 🧬🧪🔬🥼

Want to know about the microbiology of Lake Victoria and potential cyanotoxins? Check out our new paper in EMiR dx.doi.org/10.1111/1758-2… by the amazing X-less Kate Brown with great help from Ryan Wagner, KMFRI, Kisii University, Mike McKay and Prof. Lewis Sitoki:

Excited to see Colleen Yancey, PhD and I's (among many coauthors Greg Dick David H. Sherman Ashu Tripathi) joint effort out now! Spoiler alert that these bugs are capable of producing much more than microcystins... doi.org/10.1128/msyste…

New record. Society of Environmental Journalists (SEJ) toledoblade.com/local/environm…