Jake Wintermute 🥥/acc (@synbio1) Twitter Takip Ettikler • TwiDoom

John Cumbers

@johncumbers

Join @SynBioBeta - May 5-8, 2025 in San Jose: synbiobeta.com/events/synbiob… and read my weekly newsletter: synbiobeta.com

+ Follow

Henry Lee

@hhlee

Building @cultivariumFRO. I like bio+hardware+software. Views can be yours too.

+ Follow

Christina Agapakis (🥥/acc)

@thisischristina

🧬🦠🧫🌱🥩🌽🦀🐉 exploring and helping wherever biology, technology, and people collide at oscillator.bio

+ Follow

Jason Kelly

@jrkelly

Co-founder and CEO at Ginkgo Bioworks ($DNA)🧬 Chair of US National Security Commission on Emerging Biotechnology 🇺🇸

+ Follow

Michael Baym

@baym

Microbiology, evolution, applied math, molecular biotech. Associate Professor @HarvardMed. “The scholarship… is nearly non-existent.” -Reviewer 3

+ Follow

Olivier TOMAT

@oliviertomat

Director of Genopole Entreprises @Genopole Formerly, among other stuff, French gvt @UCBerkeley. Biotech, startups, growth, science. Views obviously my own.

+ Follow

Patrick Boyle — e/🦀

@p_maverick_b

I was a Synthetic Biologist before it was cool. CSO at Ginkgo Bioworks. @patrickboyle on 🟦☁️ and @p_maverick_b on 🧵

+ Follow

Bradd Libby

@bradd_libby

I help companies & other organizations understand the impacts that rapid changes in technology, the climate, economics & society might have on them & the world

+ Follow

Rob Sarvis

@robsarvis

Tuesday’s child. Minus the grace. 💀🎃👻

+ Follow

Ginkgo Bioworks

@ginkgo

The organism company. $DNA

+ Follow

Phillip Kyriakakis

@breakliquid

Senior Research Scientist at Stanford Bioengineering | Taking apart and building biology.

+ Follow

Sri Kosuri

@srikosuri

Cofounder & CEO, @octantbio

+ Follow

🧬🚄🏗️

@jdxboucher

Synthetic biology, cell and gene therapy. Member of the Leonard Lab at Northwestern University. Public transit and techno enthusiast. Views are my own.

+ Follow

Sebastian S. Cocioba🪄🌷

@atinygreencell

Amateur 🌿 Biologist • Aspiring 🌺 Designer Researcher at Binomica Labs • Degreeless Heathen • Petunia Breeder • Open Lab Notebook: tinyurl.com/ATGCFFE

+ Follow

Thomas Gorochowski

@chofski

Synthetic biologist, programmer of cells, and lover of all things visual. Wakes up in the morning to learn some of natures secrets and do a spot of fly fishing.

+ Follow

Kyle I, PhD 🕊️🇺🇦☮️

@kyle_i_phd

Neuroscientist turned Digital Hype Man for Democrats! 😤 48k strong on TikTok 🫡 Supporting Dem candidates, ALL UP AND DOWN the ballot!! 🤩 #LeaveNoDemBehind 💙

+ Follow

Tshepo Mohlala

@tscepo

Working on something old. Prev. @aspectdotapp, YC, Pioneer, UChicago.

+ Follow

Leonardo Rios

@drleorios

Assoc Prof @UCLBiochemEng1 | Advancing the frontiers of #SynBio 🧬 & Metabolic Engineering | Championing Microbial Cell Factories | Lead @LeoRiosLab | 🇲🇽🇬🇧

+ Follow

Megan J Palmer

@meganjpalmer

Engineering Biology at Social Scales. Senior Director of Public Impact @Ginkgo, Adjunct Professor @StanfordBioE, Advisor @iGEM, Director @Revive_Restore.

+ Follow

Maxim Greenberg

@maxvcg

Group leader @IJMonod. When I say "epigenetics" what I really mean is "DNA methylation".

+ Follow

Nikhil 🎬👁️// nikhil.sol

@nkumar23

Making something every day // @solanafndn @palantirtech @teachforamerica @coursera @itp_nyu

+ Follow

Dave Savage

@dfsavage

Professor at UC Berkeley | Biochemistry of CO2 Assimilation | Husband | Dad

+ Follow

Coskun Dolanbay

@cdolanbay

Better the Future at @gaenstitusu Enabler, traveler, learner. So, what's next?

+ Follow

Corinne Okada Takara

@corinnetakara

Artist/STEAM educator who develops collaborative public art projects. Diving into biomaterials. Formerly @xinampa_bio & @biojamcamp nestmakerspace.weebly.com

+ Follow

Emily Wrenbeck

@leupside

Head of Protein Engineering at @Ginkgo. she/her/hers

+ Follow

Jaya Joshi

@jayajoshi20

Assistant Professor at #UBC Vancouver #BioproductBiotech. Past #ADHansonLab,#UF,#Concordia,#WesternU,#AAFC.Interested #SynBio,#DirectedEvolution,#ClimateCrisis

+ Follow

Tom Ellis

@proftomellis

Synthetic Biology & Synthetic Genomics @ Imperial College London and the Sanger Institute. Bilingual in English and DNA.

+ Follow

Andy D Lee

@andy_d_lee

Cofounder @vincerebio bridging AI and Biology. On a mission to conquer age related decline.

+ Follow

Gariel Sylvain

@sylvaingariel

+ Follow

Elliot Hershberg

@elliothershberg

Genomics @Stanford, writing centuryofbio.com, writing/investing @notboringco

+ Follow

Olivier Borkowski

@o_borkowski

Tenured Scientist in Synthetic Biology (Paris Area) Cell-Free ⦁ SynBio ⦁ Bioengineering ⦁ Microbiology @INRAE_Micalis & @UnivParisSaclay

+ Follow

mary williams

@plantteaching

Promoting SciComm, teaching, equity & inclusion in plant biol PI NSF RCN: ROOT&SHOOT. Features Editor @ThePlantCell @PlantPhys. @[email protected]

+ Follow

SynBioBeta

@synbiobeta

Biologize the Future May 5-8, 2025 San Jose Convention Center, California

+ Follow

Steven ten Holder — e/bio

@steventen

cooking bio x ai // co-founder @acornbiolabs // @ycombinator S16

+ Follow

Benjamín Mendoza

@bnnnjmn

UNAM CDMX 🇲🇽 Biology student, synbio at @synbio_unam 🔨 Believe in #Synbio #MoveWithAPurpuse

+ Follow

Dr. Nicole Paulk

@nicole_paulk

CEO, Founder, President of @SirenBio. Universal #AAV #GeneTherapy for #Cancer.🦪 Oysters are my weakness.

+ Follow

Twist Bioscience

@twistbioscience

Synthetic DNA for Health & Sustainability #WeMakeDNA #TwistBlog #WritingTheFuture #TwistBiopharma #ScienceDoesntStop #DiversityIsInOurDNA

+ Follow

Biorizon

@biorizon

Shared Research Center Biorizon: The Profitable Way to Biobased Aromatics | TNO, VITO & Green Chemistry Campus | Tweets @EmkeMol

+ Follow

Manuel M

@mm03993418

gatgaagcgcgccgcgaagcggatgaacgcccgctggaagcgagcgaaagcgcgtatcatatt

+ Follow

Vega Shah

@dr_alphalyrae

Life Sciences & Healthcare AI @NVIDIA 🧬 previously bio software @Benchling, @Dotmatics 🚀 did research at @JGI, @UW & @Cal👩🏻‍🔬 views mine, not my employer's

+ Follow

Sam Finlayson

@iamsamfin

MD, PhD. Pediatrics-Genetics Resident @UWPedsRes Past: @harvardmed, @MIT_CSAIL, @Stanford Interests: Machine learning, Pediatrics, Rare Disease

+ Follow

Dr. Shelby

@shelbynewsad

Imbibing life and science in equal parts. Investor @compoundVC | Writing shelbyann.substack.com | Cambridge PhD @plantsci | @OhioState Biochem

+ Follow

Jose Jimenez - @jjimenez.bsky.social

@jijzarco

Reader in Synthetic Biology @imperialcollege. #synbio and evolution for health, the environment and the circular economy

+ Follow

Gnopercept

@gnopercept

verisimilitude

+ Follow

Hendrik Cooper

@cooper_hendrik

Head Industry Officer (@gasb_synbio) | iGEM Grand Prize 2018 - Marburg | SynBio Enthusiast 🧬 | Sustainability ♻️

+ Follow

Claudia Vickers

@claudiaevickers

Scientist, entrepreneur, and consultant. Synbio, isoprenoids, met eng. Making a difference. Adj Prof @QUT.

+ Follow

SoggyKiwi

@kiwisoggy

+ Follow

Jeffrey Cameron

@jccameron777

+ Follow

Tessa

@the_tessallator

computational immunology and transcriptomics @KiraGenBio | formerly @MIT @harvardmed and @hgsuuaw healthcare | she/her 🏳️‍🌈👩‍💻

+ Follow

Katie Galloway

@gallowaylabmit

Assistant Prof @MITChemE ; mom^4 + wife; enjoys building cell-fate circuits, exploring dna topology, reprogramming the living world, and soccer; soli gloria deo

+ Follow

Sofia Sanchez 🧬🌱🧠

@sofiasbio

Biopunk / Stanford, 776, Imperial

+ Follow

Abbe_Hyde

@abbe_hyde

Founder @wine_ly | Exocule helping understand and unlock great fermentation at scale. Poems for tech founders @ tinyurl.com/yc2urb4v

+ Follow

allis🦠n ✨

@allisonmegow

Scientist + Writer. Southerner in the midwest. Sometimes I take photos. 100 percent cool shit nonetheless. (views are my own, this is a personal account ☘️)

+ Follow

Carlos E Alvarez, PhD

@carlosealvare17

I study complex genetics & molecular pharmacology. Interests include canine-human comparative genomics of behavior, cancer & pleiotropy; & alpha arrestins.

+ Follow

So Tsuda

@soichirotsuda

CTO at bitBiome Inc. Microbial single-cell genome seq, Big microbe gene DB, Synbio, Biocatalysis and stuff. Tweets are my own.

+ Follow

corporate weapon

@vassilova

unprofessional account - memes and bad takes only, for all work queries check my linkedin

+ Follow

Patrick Gong

@patrickgong

International Chess Master and a PhD student at UWA - Interested in Synbio - Arabidopsis farmer 🌱 - Astrobiological engineer since 2022 🚀

+ Follow

‘zurdo’

@maudusae

Mexican northeastern metalhead graduate biotechnologist. CompBiol, MachineLearning n' DataMining in Biology. I once synbio’ed. Box n’ Muay Thai.

+ Follow

Hormoz Lab

@hormozlab

Hormoz Lab at Harvard Medical School and Dana-Farber Cancer Institute. Our mission is to control biological systems to understand life and cure disease.

+ Follow